DNA/RNA questionnaire solved solution 2020 docs

DNA/RNA questionnaire solved solution 2020 docs 1. The process of copying a gene's DNA sequence into a sequence of RNA is called a) replication. b) transcription. c) translation. d) PCR. 2. The trans ...

DNA/RNA questionnaire solved solution 2020 docs 1. The process of copying a gene's DNA sequence into a sequence of RNA is called a) replication. b) transcription. c) translation. d) PCR. 2. The transcribing enzyme is a) ligase. b) dna polymerase. c) rna polymerase. d) amino-acyl transferase. 3. Which molecule contains the genetic code? a) DNA ???? b) mRNA c) tRNA d) rRNA 4. Transcription occurs along a ____ template forming an mRNA in the ____ direction. a) 5' to 3'; 5' to 3' b) 5' to 3'; 3' to 5' c) 3' to 5'; 5' to 3' d) 3' to 5'; 3' to 5' 5. which of the statements below is false? a) the genetic code is overlapping. b) the genetic code is universal. c) degenerate codons specify the same amino acids. d) the genetic code is triplet. 6. The first mRNA codon to specify an amino acid is always a) TAC. b) UAA. c) UAG. d) AUG. (MET) 7. The amino acid sequence of a polypeptide chain comprises the ____ structure of the protein. a) primary b) secondary c) tertiary d) quaternary 8. Transfer RNA's bind during translation by the a) codon. b) anticodon. c) template. 9. Of the ____ different possible codons, ____ specify amino acids and ____ signal stop. a) 20, 17, 3 b) 180, 20, 60 c) 64, 61, 3 d) 61, 60, 1 10. RNA contains which bases? a) adenine, thymine, guanine, cytosine, uracil b) adenine, thymine, guanine, cytosine c) thymine, guanine, cytosine, uracil d) adenine, guanine, cytosine, uracil 11. Which of the following statements is true regarding introns? a) introns are the parts of mrna that are translated. b) introns have no function. c) in general, human genes have fewer introns than genes of other organisms. d) introns may be involved in exon shuffling. 12. Which mode of information transfer usually does not occur? a) dna to dna b) dna to rna c) dna to protein d) all occur in a working cell 13. A geneticist isolates a gene for a specific trait under study. She also isolates the corresponding mRNA. Upon comparison, the mRNA is found to contain 1,000 fewer bases than the DNA sequence. Did the geneticist isolate the wrong DNA? a) yes, mRNA is made from a dna template and should be the same length as the gene sequence b) yes, the mrna should contain more bases than the dna sequence because bases flanking the gene are also transcribed c) no, the final mrna contains only exons, the introns were removed d) no, the mrna was partially degraded after it was transcribed 14. The effort to decipher the genetic code was led by ____ who was awarded a Nobel Prize for his work. a) nirenberg b) lederberg c) watson d) crick 15. A DNA strand with the sequence 5’ AACGTAACG is transcribed. What is the sequence of the mRNA molecule synthesized? a) AACGTAACG b) UUGCAUUGC (if it was 3’, this would be the answer) c) AACGUAACG (look at 5’) d) TTGCATTGC 16. What sequence on the template strand of DNA corresponds to the first amino acid inserted into a protein? a) TAC b) UAA c) UAG d) AUG 17. Which of the following is an example of the degeneracy of the genetic code? a) a given amino acid has more than one codon b) each codon specifies more than one amino acid c) the first two bases specify the amino acid d) the genetic code is not degenerate 18. Proteomics a) is another term for genomics in humans. b) is the study of the collection of proteins produced in a particular cell. c) is the study of proteins produced by a particular gene. d) proves that a single gene codes for only one protein. 19. The template strand of DNA for one gene may be the coding strand of DNA for another gene. a) true b) False 20. Which of the following statements is true regarding transposons? a) they are sequences of mrna that can move around in the genome. b) they exist in corn, but are not found in the human genome. c) they are the most abundant type of repeat in the genome. d) All of the above are true regarding transposons. 21. Transcription and translation of a gene composed of 30 nucleotides would form a protein containing no more than ___ amino acids. A) 10 (3 nucleotides per protein) B) 15 C) 60 D) 90 22. During translation, the ____ site within the ribosome hold the growing amino acid chain while the ____ site holds the next amino acid to be added to the chain. A) A, P B) P, A C) A, B D) B, A 23. The amino acid structure of a polypeptide chain determines its ____ structure. A) primary unless there is hairpins or loop or knots it will become secondary B) secondary C) tertiary D) quaternary 24. ____ regulate which genes or subsets of genes are transcribed in a particular cell type. A) transcription factors ???? B) chaperone proteins C) RNA polymerases D) transcription is not regulated E) operator 25. An antibiotic interferes with the ability of the ribosome to move. What affect would exposure to this chemical have on a bacterial cell? A) protein synthesis will be affected B) the protein synthesized will be shorter than normal C) the protein synthesized will be longer than normal D) no proteins will be produced 26. RNA is synthesized on a DNA template in a process called ______, which utilizes the enzyme _______ a.translation, RNA polymerase b.transcription, DNA polymerase c.transcription, RNA polymerase d) replication, DNA polymerase 27. Which of the following is NOT a necessary component of translation? a) anticodon b) mRNA c) ligase glue of DNA between two nucleotides d) amino acid 28. Given the following DNA strand, which of the following is its complementary mRNA? 3’-GGACTGATT-5’ a) C C T G A C T A A b) C C U G A C U A A c) G G A C T G A T T d) T T A G T C A G G 29. Amino acids are joined together into a protein chain by which of the following? a) transfer RNA b) DNA polymerase c) hydrogen bonds d) messenger RNA e) peptidyl transferase 30. Proteins contain ____ different amino acids, whereas DNA and RNA are composed of ___ different nucleotides a) 20, 64 b) 3, 20 c) 4, 20 d) 20, 4 31. The base pair rules states that: a) Replication is semiconservative b) A pairs with T, G pairs with C c) DNA is a double helix held together by hydrogen bonds d) A pairs with G, T pairs with C 32. Once transcription has been completed, which of the following is NOT necessary for protein synthesis to occur? a) tRNA b) ribosomes c) mRNA d) DNA already has a transcript 33. Which site of the tRNA molecule binds to the mRNA molecule? a) anticodon complementary to the codon b) codon c) amino acid d) 5 prime end 34. Okazaki fragments occur on the ___ and are bonded together by ______ a) leading strand, polymerase b) mRNA, anticodons c) lagging strand, ligase d)tRNA, polymerase 35. How many different codons are possible? a) 3 b) 20 c) 64 d) an infinite number 36. In the ladder anology of the DNA molecule, the "rungs" of the ladder are: a) sugars b) phosphates c) paired nitrogenous bases d) joined sugar and phosphate 37. Which of the following best describes the arrangement of the sides of the DNA molecule? a) twisted b) antiparallel c) bonded d) alternating 38. If a DNA molecule is found to be composed of 40% thymine, what percentage of guanine would be expected. a) 10% 40T;40A 10G;10C b) 20% c) 40% d) 80% 39. The enzymes that break hydrogen bonds and unwind DNA are: a) primers b) forks c) helicases d) polymerases 40. DNA replication results in: a) 2 completely new DNA molecules b) 2 DNA molecules that each contain a strand of the original c) 1 new DNA molecule, 1 old molecule is conserved d) 1 new molecule of RNA 41. During replication, what enzyme adds complimentary bases? a)helicase b) synthesase c) replicase e) polymerase 42. Transcription results in: a) an amino acid chain b) messenger RNA c) complementary DNA d) okazaki fragments 43. How many different amino acids are there? a)3 b)20 c) 100 d)an infinite number 44. A stretch of chromosome that codes for a trait can be called a(n): a)chromatid b)replication fork c) gene d) base-pair 45. In RNA, _____ codon(s) translate to ______ amino acid(s) a. 1, 1 b. 3, 1 c. 3, 3 d. 1, 20 46. Translation begins: a. at the replication fork b. on the lagging strand c. at the start codon d. in the nucleus 47. A nucleotide consists of: a. a phosphate and a base b. a phosphate, and a sugar c. a base and an amino acid d. a phosphate, a sugar, and a base 48. The sugar in RNA is _____, the sugar in DNA is _______ a. deoxyribose, ribose b. ribose, deoxyribose c. ribose, phosphate d. ribose, uracil 49. Which of the following is found on RNA but not DNA? a. uracil b. deoxyribose c. phosphate d. adenine 50. The 5' and 3' numbers are related to the: a. length of the DNA strand b. carbon rings in sugar c. the number of phosphates d. the base pair rule 51. Okazaki fragments occur during: a. transformation b. replication c. polymerase reaction d. synthesis 52. Adenine always pairs with: a. guanine b. cytosine c. thymine d. another adenine 53. 3. The two sides of the DNA ladder are loosely bonded together by: a. hydrogen bonds b. molecular glue c. magnetism d. polymers 54. 4. The process by which DNA makes a copy of itself is called: a. transcription b. translation c. synthesis d. replication 55. The outside of the DNA ladder (the legs) is composed of alternating ___ and a. phosphates. b. adenines c. hydrogens d. sugars e. bases 56. The twisted ladder shape of the DNA molecule is known as the: a. isohedron b. deoxyribose twist c. hydrogren twist d. double helix 57. Each column in the table below represents three nucleotides. Within each column, fill in the cells that are blank by using information from the cell that is not blank 5’3 sense CAG 3’-5’antisense 58. Which of the following is more likely to be a factor independent transcription termination site TERMINATION- forms hair pin(loop), and ends with AAAA a) 3’ ACTAGCCTAAGCATCTTGAGGCACAGAAAAAAAAATGC 5’ b) 3’ ACGTAAGGGTTTAAACGTACCCAAAAAAAAAAATCG 5’ c) 3’ AACGACTAGTACGACATACTAGTCGTTGGCAAAAAAAAAAAAAATG 59. What is the longest ORF in the mRNA? ORF- A OR C THE ONE THAT HAS LONGEST AMINO ACIDS IS ORF Find the longest…. a) 5’ CAUGGACUAAUCCUAGAUGUCGCGGGUUGACAAUUUAACUGUCGCGCCGGGUUCUGA 3’ b) 5’ CCCATGGACTAATAGATGTCGCGGGTTGACAATTTAACTGTCGCGCCGGGTTCTGA 3’ c) 5’ CAUGGACUAAUCCUAGACGUCGCGGGUUGACAAUUUAACUGUUGACCCACGUUU 3’ 60. A sequence of three nucleotides in mRNA that specifies the first amino acid in the synthesis of a polypeptide chain a) Codon b) Anticodon c) Start codon d) Nonsense codon 61. What amino acid sequence would the DNA base sequence 5’ CGCATGAAAGAGCCT 3’ code for? 62. A complex consisting of a 30S ribosomal subunit, a tRNA having the anticodon UAC and carrying an altered form of the amino acid methionine (N-formylmethionine or f-Met), and proteins called initiation factors. a) 50S or 60S ribosomal subunit b) initiation complex c) aminoacyl-tRNA Match the following with their role. 63. _____ The ribosomal subunit that binds to mRNA to form the initiation complex. 64. _____ The ribosomal site where an aminoacyl-tRNA first attaches during translation. 65. _____ The ribosomal site where the growing amino acid chain is temporarily being held by a tRNA as the next codon in the mRNA is being read. a) 30S ribosomal subunit b) P-site of ribosome c) A-site of ribosome d) E-siteofribosome e) 50S ribosomalunit 67. If a DNA strand reads 3’-TACGGCATG (where the names of the bases are abbreviated), then the RNA molecule created by transcription would read a) ATGCCGTAC b) AUGCCGUAC c) CGTAATGCA d) CGUAAUGCA 68. In the bacterial chromosome replication the DnaAmultimer complexes with ATP causes melting of an AT rich region to which another protein, DnaB/DnaC/ATP complex can then bind. a) True b) False 69. In bacteria replication continues until the replication fork enters a region of the chromosome called Ter.One replication fork will stall, the other will stop as soon as it meets the stalled fork. a) True b) False 70. terB site. Inhibits the fork clockwise moving direction. The fork clockwise moving direction fork pass through terA and stop in terBand vice-versa a) True b) False