Biology > QUESTIONS & ANSWERS > CETs Reviewer (Biology) by UPLink (questions with 100% verified correcy answers) (All)

CETs Reviewer (Biology) by UPLink (questions with 100% verified correcy answers)

Document Content and Description Below

CETs Reviewer (Biology) by UPLink (questions with 100% verified correcy answers)c - ✔✔Which of the following is not true for DNA? a. DNA stands for Deoxyribonucleic acid b. It has base pairings ... of cytosine and guanine c. DNA replication is non-conservative because both strands of the DNA are new. d. It is used to reproduce RNA. c - ✔✔Which of the following is NOT one of the nitrogen-containing bases in DNA. a. adenine b. guanine c. uracil d. cytosine a - ✔✔The central dogma of molecular biology is the flow of information from ______ to ______ to ______. a. DNA, RNA, Protein b. DNA, Protein, RNA c. RNA, Protein, DNA d. RNA, DNA, Protein b - ✔✔The process where RNA molecules interact to convert the gene's message into polypeptide chains. a. transcription b. translation c. conversion d. synthesizing b - ✔✔Which class of RNA functions as the genetic message from DNA and synthesizes protein? a. rRNA b. mRNA c. tRNA d. none c - ✔✔Which of the following mRNA sequences would produce 4 peptides? a. AGUCAAUGCAAGACUAGA b. AGAUGCGGGAGUGACA c. AUGCAGUGGAAGGAGUGA d. GCAUGUGAGAUCCCAAGAUG c - ✔✔Which of the following os NOT true? a. A cell is the basic living unit. b. A cell has the capacity to maintain itself as an independent unit. [Show More]

Last updated: 2 years ago

Preview 1 out of 7 pages

Buy Now

Instant download

We Accept: