(MB) ASCP Practice Exam Questions and Answers Solved Correctly

(MB) ASCP Practice Exam Questions and Answers Solved Correctly Which of the following is not a component of a nucleotide? Phosphate group Anti-codon Ribose sugar Nitrogen base ✔✔Anti-codon According to Chargaff's ...

(MB) ASCP Practice Exam Questions and Answers Solved Correctly Which of the following is not a component of a nucleotide? Phosphate group Anti-codon Ribose sugar Nitrogen base ✔✔Anti-codon According to Chargaff's rule of base pairing, adenine pairs with: ✔✔Thymine What genes would be screened in a breast cancer panel? ✔✔HER2, ERBB2, BRCA1 Next Generation Sequencing uses: ✔✔Short sequence reads Purines and pyrimidines differ from each other in that: ✔✔Purines have two rings; pyrimidines have one ring The purines are: Cytosine and uracil Adenine and thymine Thymine and cytosine Adenine and guanine ✔✔Adenine and guanine What is the rate of mutation per round of DNA replication? 1 in 1,000 base pairs 1 in 10,000 base pairs 1 in 1,000,000 base pairs 1 in 1,000,000,000 base pairs ✔✔1 in 1,000,000,000 base pairs The rate of DNA migration through an agarose gel during electrophoresis does not depend on which of the following factors? Net charge of the molecule Size of the molecule Shape of the molecule Nucleotide sequence of the molecule ✔✔Nucleotide sequence of the molecule What are the phases in a qPCR Amplification Plot? Initiation, exponential, plateau Baseline, exponential, plateau Baseline, threshold, exponential, plateau Baseline, initiation, threshold, exponential, plateau ✔✔Initiation, exponential, plateau Find the palindrome in this restriction enzyme site: 5'-CTGCAG-3'? 5'-GAC 3'-GAC 3'-CTG 5'-GTC ✔✔3'-GAC A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a singlegene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntington gene. Testing with standard PCR indicates that patient has Huntington Disease, HD. Which of the following would be consistent with this diagnosis? 25 CAG repeats in the Huntington gene 85 CAG repeats in the Huntington gene 25 CGA repeats in the Huntington gene 85 CGA repeats in the Huntington gene ✔✔85 CAG repeats in the Huntington gene Which two HPV types are responsible for most cases of cervical cancer? 16 and 18 31 and 59 16 and 58 44 and 59 ✔✔16 and 18 Replication forks, known as origins of DNA replication, are created by this enzyme: Ligase Taq Polymerase Primase Helicase ✔✔Helicase Mutation in what gene is associated with Fragile X syndrome? ✔✔FMR1 Mantle cell lymphoma (MCL) is caused by what translocation? ✔✔t(11;14) This polymerase is involved in "initiation of DNA replication and has primase activity": ✔✔Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments ✔✔Okazaki fragments What gene is measured following treatment with imatinib (Gleevec)? FLT3 BCR/Abl Jak2 MAPK ✔✔BCR/Abl What is the rate of mammalian DNA replication? 500 nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second ✔✔50 nucleotides per second This polymerase is involved in "replicates mitochondrial DNA": ✔✔Pol γ A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a singlegene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation-specific PCR Standard PCR PFGE RAPD PCR ✔✔Standard PCR Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22-25ºC 2-8ºC -20ºC -70ºC ✔✔-70ºC Consider a hypothetical mutation involving gene X. Let's say you amplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp ✔✔m/+ = 350 bp; 250 bp; 100 bp Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? Increase the concentration of salt in the wash solution buffer Increase the temperature from, say 68°C to 75°C Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density Remove formamide from the wash solution buffer ✔✔Increase the concentration of salt in the wash solution buffer What enzyme is involved in LCR? ✔✔DNA Ligase Next Generation Sequencing set-up require: Library preparation and extensive bioinformatics analysis BAC clones Use of translation factors Hybridization ✔✔Library preparation and extensive bioinformatics analysis Which of the subunits of RNA polymerase holoenzyme is responsible for promoter recognition? Beta subunit Sigma subunit Gamma subunit Delta subunit ✔✔Sigma subunit While at the doctor's office with your father, you overheard his physician tell another physician that test results came in, confirming the presence of the Factor V Leiden mutation, a mutation associated with deep venous thrombosis. Which of the following is the mutation your father has: A1691G G1619A 1691G>A C282Y ✔✔1691G>A Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 60°C 58°C 64°C 62°C ✔✔58°C This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol I RNA Pol II DNA Pol II ✔✔RNA Pol I Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as: ✔✔Pleiotrophy What assay amplifies the target using a combination of a three-enzyme system? Branched DNA TMA PCR NASBA LCR ✔✔NASBA In what part of a qPCR Amplification Plot do you take your measurement? ✔✔Exponential phase All of the following are liquid tumors, except: Mantle cell lymphoma Ewing sarcoma Burkitt's lymphoma Acute promyelocytic leukemia ✔✔Ewing sarcoma A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is: ✔✔(2.545 * 50ng/mcl)= 127.25 (127.25ng/mcl * 0.30) = 38.175ng/mcl 38.175ng/mcl ( 0.800mL1000) = 3054 micrograms According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair with: U or C A or G A, C or G Only A ✔✔A or G This polymerase acts on DNA and produces Messenger RNA: ✔✔RNA Pol II What assay amplifies the probe signal and the probe RNA concentration increases if the target to be detected is present? Branched DNA TMA PCR NASBA LCR Qβ replicase ✔✔Qβ replicase This restriction enzyme "digests and adds a methyl group from Adenine": Type I Type II Type III DNase I ✔✔Type III What increases the half-life of mRNA? 5' Methyl Cap 3' Methyl Cap Poly-A tail 5' Methionine Cap ✔✔5' Methyl Cap A parent has an autosomal dominant disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% ✔✔50% The phrase "central dogma of molecular biology" refers to the flow of genetic data in this manner: DNA --> RNA --> Proteins DNA -->Proteins --> Genes RNA --> DNA --> Proteins RNA --> Proteins --> DNA ✔✔DNA --> RNA --> Proteins What drug is NOT metabolized by CYP2D6? Codeine Omeprazole Warfarin Escitalopram ✔✔Warfarin You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCctggcacgacaggtttcccgactgg The mutation observed is a: Frame-shift mutation Insertion Silent mutation Non-conservative mutation ✔✔Frame-shift mutation A parent has an autosomal recessive disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% ✔✔100% Which DNA polymerase is responsible for copying DNA by reading existing strand, building new complementary strand and always adds to 3' end, but can't start a new strand on its own (ORI sites)? DNA Polymerase III DNA Polymerase I Gyrase None of the choices listed ✔✔DNA Polymerase III How many log10 reductions in HIV viral load is considered to be successful upon treatment? 0.5log10 1log10 2log10 3log10 ✔✔0.5log10 Which of the following is not a characteristic of a tRNA molecule? D arm Beta arm T arm Anti-codon arm ✔✔Beta arm This translocation creates a fusion protein between the Abl1 gene on one chromosome and the BCR gene on the other chromosome, resulting in chronic myelogenous leukemia (CML): ✔✔t(9;22) What stain binds to minor groove of DNA Duplex? ✔✔SYBR1 Which of the following best characterizes a vector? helps carry DNA into cell ie plasmids, virus allows formation of double-stranded molecules initiates replication during PCR decodes mRNA ✔✔helps carry DNA into cell ie plasmids, virus Between which phosphate groups is the linkage between the GTP molecule and RNA chain in the 5' cap? Beta-beta Alpha-gamma Gamma-beta Alpha-beta ✔✔Alpha-beta This restriction enzyme "digests and removes a methyl group from Adenine": Type I Type II Type III DNase I ✔✔Type I Primer dimers are due to what complimentary issue? 3' to 3' complementarity of primer pairs 3' to 5' complementarity of primer pairs 5' to 5' complementarity of primer pairs 5' to 3' complementarity of primer pairs ✔✔3' to 3' complementarity of primer pairs The hydroxyl group in a deoxyribonucleotide is expected to be found on which position of the sugar? C1' C2' C3' C4' ✔✔C3' Nucleic acid hybridization methods can be affected by a host of factors. Select all the factors that that can influence this process. G:C ratio of bases pH of the hybridization reaction Hybridization temperature All of the above ✔✔All of the above A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. The concentration of DNA in this extract is: 76.35 micrograms/mL 3817.5 micrograms/mL 381.75 micrograms/mL 3054.0 micrograms/mL ✔✔3817.5 micrograms/mL Mutation in UGT1A1 affects metabolism of what drug? ✔✔Ironotecan Testing for HOXB13, BRCA1 and BCRA2 is usually done in patients with: ✔✔Prostate cancer RT-PCR can be used to quantify messenger RNA (mRNA) among other uses. All of the following concerning RT-PCR are true, EXCEPT: RT-PCR is useful in detecting RNA-viruses, such as HIV RT-PCR uses alkaline phosphatase to reverse amplify the signal RT-PCR produces cDNA using RNA templates ✔✔RT-PCR uses alkaline phosphatase to reverse amplify the signal Southern blot can be used for all of the following purposes, except: Paternity testing Chromosomal staining Gene discovery and mapping Mutation analysis and identification ✔✔Chromosomal staining If a woman is infected with the HPV virus, which of the following parameters increases her risk of developing cervical cancer? A vegetarian diet Never having been pregnant Obesity Smoking ✔✔Smoking Which of the following is not a common hydrogen bond acceptor? A carbonyl Primary amine Hydroxyl Tertiary amine ✔✔Primary amine T-Cell Gene Rearrangement is seen in what malignancy? Sézary syndrome Burkitt's lymphoma Non-Hodgkin Lymphoma Polycythemia vera ✔✔Non-Hodgkin Lymphoma The t(11;22) translocation is responsible for: ✔✔Ewing sarcoma In CML, what fusion protein is created? EWS-FLI1 EWS-PAR2 BCR-Abl1 c-myc-IGH ✔✔BCR-Abl1 As a technologist working in a small clinical laboratory, a nasal swab specimen, suspected to be colonized by a variety of upper respiratory viruses, came to your laboratory. You are tasked with determining whether the specimen is colonized with rhinovirus, coronavirus, and influenza. Which PCR method would best be suitable for this task? Nested PCR Real-time PCR NASBA Multiplex PCR ✔✔Multiplex PCR All of the following methods of amplification are considered target amplification, except: Quantitative PCR NASBA Strand Displacement Amplification Reverse Transcriptase PCR ✔✔NASBA Which of the following reagents will successfully decontaminate a bench top that has been exposed to DNA amplification products? 70% Ethanol 5% Bleach 100% Isopropanol 10% Methanol ✔✔5% Bleach All of the following are components of nucleic acids, EXCEPT: Phosphate group Sugar (ribose or deoxyribose) Nitrogenous base (A, G, C, T) Formamide ✔✔Formamide The amelogenin locus, found on the sex chromosomes, is used in gender identification. Amplification at this locus reveals 2 peaks of sizes 212 and 218 base pairs. If this amplification were part of a gender identification procedure, what would be the gender of the individual? Male Female Hermaphrodite Can't be determined from the given information ✔✔Male What assay amplifies the target using DNA polymerase? Branched DNA TMA PCR NASBA LCR ✔✔PCR During DNA replication, the 3' -OH of the growing DNA chain attacks which phosphate of an incoming nucleotide? Alpha Beta Gamma Delta ✔✔Beta What gene is measured following treatment with Warfarin? FLT3 VKORC1 MAPK P53 ✔✔VKORC1 The process of making proteins is termed: Replication Translation Transcription Sequencing ✔✔Translation How many polymorphisms can be found in the human genome? Approximately 10 million Approximately 100 thousand Approximately 1 billion Approximately 1 million ✔✔Approximately 10 million This highly polymorphic loci region is crucial in assessing immune system compatibility: VNTRs HLA SINES SNPs ✔✔HLA Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? 5'-ATCTATGTCGGCAATT-3' 5'-TTAACGGCTGTATCTA-3' 5'-AATTGCCGACATAGAT-3' 5'-GAGCACGCTATCTTAT-3' ✔✔5'-ATCTATGTCGGCAATT-3' Mutations in the CFTR gene is associated with what disease? Fragile X Cystic Fibrosis Sickle-cell anemia Mantle Cell Lymphoma ✔✔Cystic Fibrosis The mother of a 3 year old boy took him to the doctor's office for concerns of an underlying genetic condition. A karyotype order was sent to the Molecular Diagnostic lab. Karyotype results show 47, XY,+21. Based on these results, the boy has: Patau Syndrome Down Syndrome Edward Syndrome Cri du chat Syndrome ✔✔Down Syndrome In real-time PCR, what is amplified? The target The signal The probe All of the above ✔✔The target When sequencing HLA-DR what is targeted? Exon 1 of the α subunit Exon 2 of the α subunit Exon 1 of the β subunit Exon 2 of the β subunit ✔✔Exon 2 of the β subunit What is the rate of DNA translation? 80 nucleotides per second 200 nucleotides per second 60 nucleotides per second 40 nucleotides per second ✔✔60 nucleotides per second This PCR method works by generating a signal at the annealing step (i.e. when the probe binds its target) of the PCR reaction: FRET probes Scorpion primers Molecular beacons Taqman ✔✔Molecular beacons What is the most common mutation in Hemochromatosis? 1691G>A F508del R506Q C282Y ✔✔C282Y Mutation in this gene (Xp21) is associated with Duchenne Muscular Dystrophy: Dystrophin P53 Musculin C-myc ✔✔Dystrophin What is the sequence recognized by poly (A) polymerase? TATAAA CAA CCCGAA AAUAAA ✔✔AAUAAA Splicing is the process that does which of the following? Remove exons and preserve introns Remove introns and preserve exons Remove mutated regions of primary transcript RNA (tRNA)? Add a poly-A tail to the end of a primary RNA transcript? ✔✔Remove introns and preserve exons Which of the following statements are characteristics of the melt curve analysis? (hint: more than one answer) -At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. -The melting temperature of double stranded DNA depends on its base composition and length. -All PCR products for a specific primer pair should have the same melting temperature. -When hybridization probes are utilized, the temperature is incrementally decreased while fluorescence is monitored. ✔✔-At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. -The melting temperature of double stranded DNA depends on its base composition and length. -All PCR products for a specific primer pair should have the same melting temperature. Acute promyelocytic leukemia (APL) is responsible for what translocation? ✔✔t(15;17) What genes would be screened in a colorectal panel? KRAS, BRAF, PIK3CA HER2, ERBB2, BRCA1 KRAS, EGFR, ALK MSH2, PMS2, EPCAM ✔✔KRAS, BRAF, PIK3CA What responds poorly to Ribavarin/Interferon treatment? HCV type 1 HCV type 2 HCV type 3 HCV type 4 HCV type 1 & 4 HCV type 2 & 3 ✔✔HCV type 1 & 4 If two parents are heterozygous for an autosomal recessive disease, then their offspring will most likely follow this gene frequency pattern: -25% homozygous dominant, 50% heterozygous, and 25% homozygous recessive -50% homozygous dominant, and 50% homozygous recessive -100% homozygous for the dominant phenotype -100% homozygous for the recessive phenotype ✔✔25% homozygous dominant, 50% heterozygous, and 25% homozygous recessive This polymerase acts on DNA and produces Transfer RNA: RNA Pol II DNA Pol II RNA Pol III DNA Pol III ✔✔RNA Pol III What assay is a signal amplification test and uses Alkaline Phosphatase? Branched DNA TMA PCR NASBA LCR ✔✔Branched DNA What genes would be screened in a lung cancer panel? KRAS, BRAF, PIK3CA HER2, ERBB2, BRCA1 KRAS, EGFR, ALK MSH2, PMS2, EPCAM ✔✔KRAS, EGFR, ALK Which of the following molecular methodologies would be the best for detecting a trinucleotide repeat disorder such as Huntington's disease? Heteroduplex analysis Variable number tandem repeat analysis Single strand conformation polymorphism analysis Reverse-Transcriptase PCR ✔✔Variable number tandem repeat analysis Which method would best be used to detect the Leiden mutation? PCR-RFLP bDNA amplification PFGE Ribotyping ✔✔PCR-RFLP Which of the following is not a step in the Southern blot procedure? DNA digest with restriction enzymes Gel resolution of fragments Fragments denaturation Probe digest ✔✔Probe digest Bone marrow transplantation is a great method used to treat several malignant and benign cancers, particularly leukemias. Before transplantation (or engraftment analysis), several polymorphic loci are screened in both the recipient and donor cells. The main goal of this screening is to: -find at least one or more informative loci between both the donor and recipient -find exactly ten informative loci between both the donor and recipient -find all the non-informative loci between both the donor and recipient -find the blood type/group of both the donor and recipient ✔✔find at least one or more informative loci between both the donor and recipient A DNA specimen was sent to your Molecular Diagnostics Laboratory for DNA sequencing, in order to determine whether patient A has a particular mutation in gene X. The gene sequence is known. However, the gene mutation itself is not known. Therefore, DNA sequencing cannot be performed on this DNA specimen. (True or False) True False ✔✔True After an amplification procedure followed by gel electrophoresis, you took a photo of your gel. You notice consistent bands in all your gel lanes. However, you also see what appears to be a faint but noticeable band in your reagent blank lane. What is your best explanation for the reagent blank band? -Taq polymerase concentration was too low in this PCR reaction -There was obvious contamination in this PCR reaction -The primers concentration was too high in this PCR reaction -The dNTPs concentration was too high in this PCR reaction ✔✔There was obvious contamination in this PCR reaction In mantle cell lymphoma (MCL), this is the fusion gene created: EWS-FLI1 CCND1-IGH BCR-IGH c-myc-EWS ✔✔CCND1-IGH This enzyme is known for "unzipping" genes! Alkaline Phosphatase RNA polymerase Apyrase Helicase ✔✔Helicase Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? 5'-ATCTATGTCGGCAATT-3' 5'-TTAACGGCTGTATCTA-3' 5'-AATTGCCGACATAGAT-3' 5'-GAGCACGCTATCTTAT-3' ✔✔5'-ATCTATGTCGGCAATT-3' What is the optimum storage condition for any specimen (whole blood, bone marrow, tissue etc.) awaiting RNA extraction? -Remove contaminating RBCs then immediately freeze at -20°C -Prepare a lyophilized cell pellet and store at room temperature -Refrigerate at 4°C indefinitely ✔✔Remove contaminating RBCs then immediately freeze at - 20°C Which of the following is not a PCR step? Denaturation Elongation Annealing Termination ✔✔Termination Which PCR method has the highest specificity? qPCR Touchdown PCR Nested PCR Two-step PCR ✔✔Nested PCR All of the following enzymes are part of the DNA replication machinery, EXCEPT: Ligase DNA polymerase Luciferase Helicase ✔✔Luciferase What is the name of the molecule that is added to the 5' end of eukaryotic RNA transcripts? ATP SnRNP GTP Phosphate ✔✔GTP What is multiplex PCR? -A PCR technique to amplify multiple targets -A PCR technique where a preamplified amplicon is amplified to increase sensitivity -A PCR technique where a preamplified amplicon is amplified to increase sensitivity A PCR technique that combines reverse transcription and amplification in one reaction -A PCR technique where various samples can be amplified in one reaction ✔✔A PCR technique to amplify multiple targets Codons that code for the same amino acid are called: Synonyms Similar Degenerates Complements ✔✔Synonyms When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen as approximately: ΔCt = 1 ΔCt = 3.3 ΔCt = 10 ΔCt = 6.6 ✔✔ΔCt = 3.3 Deletion in the paternal chromosome 15: del(15)(q11q13) results in Prader-willi syndrome. However, deletion in the same region in the maternal chromosome results in a completely different condition known as Angelman syndrome. This phenomenon is an example of: Mosaicism Loss of heterozygosity Hemizygosity Genomic imprinting ✔✔Genomic imprinting What translocation results in synovial sarcoma, a muscle and fibrous tissue cancer? ✔✔t(18;X) Testing for Aldehyde Dehydrogenase deficiency is important in patients with: Alcohol dependence Diabetis Lactic acidosis Obesity ✔✔Alcohol dependence You could use all of the following methods to test for the the t(9;22) translocation, except: FISH Southern blot Reverse-transcriptase PCR Ribotyping ✔✔Ribotyping The nitrogenous base in a nucleotide is expected to be found on which position of the sugar? C1' C2' C3' C5' ✔✔C1' Which of the following is not a mutation found in the HFE gene of hemochromatosis? C282Y H63D 5382insC S65C ✔✔5382insC Clinical laboratories must have clearly written protocols in place describing handling of specimens for clinical testing. Many factors can affect testing performance before the actual testing is conducted. Such factors or variables are collectively known as pre-analytical. From the list below, select all the pre-analytical variables that can have a negative impact on clinical testing (Hint: more than one answer choice!) -Storage conditions -Patient identifiers -Anticoagulant in collection tubes -Transport procedures -Introduction of Heparin in all blood tubes to maintain specimen integrity for testing -Thermo cycling parameters -DNA isolation method used -Testing analysis software used ✔✔-Storage conditions -Patient identifiers -Anticoagulant in collection tubes -Transport procedures What translocation is associated with Burkitt's lymphoma? ✔✔t(8;14) What does the term consanguinity refer to? -The lines on a pedigree used to show relationships between siblings -The first affected family member coming to medical attention -The line of descent on a pedigree used to show relationships between parents and children -Individuals that share a common ancestor or are considered "of the same blood" -Neither of the listed choices ✔✔-Individuals that share a common ancestor or are considered "of the same blood" There are many types of RNA molecules, each of which has a specific function within the cell. Which type of RNA molecule is responsible for transporting amino acids during protein synthesis? Transfer RNA (tRNA) Ribosomal RNA (rRNA) Messenger RNA (mRNA) Small Nuclear RNA (snRNA) MicroRNA (miRNA) ✔✔Transfer RNA (tRNA) What is the best way to store RNA for longer than a month? -In nuclease free (DEPC-treated) water, at -20°C or -80°C -In TrizolⓇ, at -20°C or -80°C -In Ethanol, at -20°C or -80°C -In DMSO, at -20°C or -80°C ✔✔In Ethanol, at -20°C or -80°C How many hydrogen bonds are formed between one C:G base pair? 1 2 3 4 ✔✔3 What is the enzyme responsible for stitching together Okazaki fragments? Helicase Single-stranded DNA binding protein Primase Ligase ✔✔Ligase How is warfarin dosage affected in patients with VKORC1 deficiency? Patients receive a higher warfarin dose Patients receive a lower warfarin dose Warfarin dosage is unaffected ✔✔Patients receive a lower warfarin dose When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes them! Thermosequenase Helicase Primase Ligase ✔✔Ligase In which of the following methods is the probe digested by the polymerase (Taq) during primer extension? Taqman FRET probes Molecular beacons Scorpion probes ✔✔Taqman Which of the following is not a source of DNA damage? Chemical damage Splicing Attack by water Radiation damage ✔✔Splicing All of the following are trinucleotide repeat disorders, EXCEPT: Spinocerebellar Ataxia Type 8 Huntington Disease Asperger Disease Fragile X Disease ✔✔Asperger Disease This polymerase is involved in "short-patch base excision repair": Pol α Pol β Pol γ Pol δ ✔✔Pol β You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCTGctggcacgacaggtttcccgactgg The mutation observed is a: Frame-shift mutation Insertion Silent mutation Non-conservative mutation ✔✔Insertion The 5' capping process creates what type of linkage? 5'-3' 3'-5' 5'-5' 3'-3' ✔✔5'-5' A reverse dot blot is best performed by: -Immobilizing multiple unlabeled probes onto the membrane and then allowing one labeled sample to hybridize to the unlabeled probes -Immobilizing one labeled probe onto the membrane and allowing multiple labeled samples to hybridize to the labeled probe -Immobilizing multiple unlabeled probes onto the membrane and allowing multiple unlabeled samples to hybridize to the unlabeled probes -Allowing a single labeled sample to hybridize to multiple labeled single stranded probes onto the membrane ✔✔-Immobilizing multiple unlabeled probes onto the membrane and then allowing one labeled sample to hybridize to the unlabeled probes What signals the end of transcription? Stop codon Terminator The end of the DNA chain RNA polymerase runs out ✔✔Terminator Which of the following is not a characteristic of eukaryotic DNA transcription? Multiple RNA polymerases TATA-binding protein Strict promoter sequences Transcription factors ✔✔Strict promoter sequences What enzyme is crucial in the making RNA from DNA? DNA Polymerase RNA Polymerase Helicase Primase ✔✔RNA Polymerase What is the predominant form of DNA? A Form B Form Z Form G Form ✔✔B Form Why is it critical to maintain workflow from "clean" to "dirty" while working in a molecular lab? -To ensure that all equipment is being utilized to its full potential -To prevent amplified products from entering the post-PCR detection area of the laboratory -To avoid contamination of specimens with amplified product which create false positive results -To allow "dirty"(or infected) patient samples to become decontaminated before running an assay ✔✔-To avoid contamination of specimens with amplified product which create false positive results In a retrovirus the RNA acts as: Genome and mRNA mRNA Genome rRNA ✔✔Genome and mRNA Imagine you are working in specimen processing for the molecular laboratory and you receive a patient's specimen collected in a lavender top vacutainer tube containing EDTA. The test that is ordered requires that the specimen be collected in a yellow top ACD vacutainer tube. What is the BEST action to take in this instance? -Reject the specimen, inform the supervisor and request a new specimen drawn in ACD -Process the sample according to laboratory protocol because EDTA does not interfere with molecular testing methods -Document the tube additive change, process the sample, run the test, and hold the results until a supervisor or laboratory director signs off -Follow the prescribed laboratory protocol for accepting and rejecting specimens -Both B & D are correct -Both C & D are correct ✔✔-Follow the prescribed laboratory protocol for accepting and rejecting specimens Which of the following is not involved in the splicing reaction? 5' splice site Hairpin loops Branch A point 3' splice site ✔✔Hairpin loops What assay amplifies the target using reverse transcriptase? Branched DNA TMA PCR NASBA LCR ✔✔TMA To what does the AcrAB gene product create resistance to? Tetracycline Penicillin Vancomycin Erythromycin ✔✔Tetracycline The phosphate group in a nucleotide is expected to be found on which position of the sugar? C1' C2' C4' C5' ✔✔C5' Which of the following is not a probe-labeling method? Labeling by random priming Labeling by nick translation End-labeling (using a terminal transferase enzyme) Labeling by hybrid capture ✔✔Labeling by hybrid capture This enzyme is known for "unzipping" genes! Alkaline Phosphatase RNA polymerase Apyrase Helicase ✔✔Helicase What volume of DNA (in microliters) is required to prepare a restriction digest that requires 10 µgs of DNA when the stock DNA is 5 µg/µl? 0.5 µl 1 µl 2 µl 5 µl ✔✔2 µl Which one of the following complementary pairings is incorrect? A=T G=C U=T A=U ✔✔U=T What is the advantage of Next Generation Sequencing (NGS) over traditional Sanger Sequencing? -Ability to sequence multiple mutation variants of a single gene at a single time -Preparation of a library -Easy setup -Use of a barcode reader ✔✔Ability to sequence multiple mutation variants of a single gene at a single time What links codons and anti-codons together during DNA translation? DNA ligase Single-stranded binding protein Complementary base pairing GTP ✔✔Complementary base pairing Both parents are carriers of an autosomal recessive disorder. What percent chance do these parents combined have to pass down this affected gene to their child? 0% 25% 50% 75% 100% ✔✔75% A cerebrospinal fluid (CSF) sample for hematologic evaluation should be tested within how many hours of collection? 1 hour 2 hours 3 hours 4 hours ✔✔1 hour Blood drawn into what type of tube is compatible for Genetic testing? K2EDTA tube Sodium citrate tube Sodium Heparin tube Boric acid, sodium formate tube ✔✔K2EDTA tube