Bio 101 NVCC Final Exam

Document Content and Description Below

Bio 101 NVCC Final Exam Meiosis results in - ✔✔4 different haploid cells The purpose of meiosis is to - ✔✔produce gametes (eggs and sperm) There are _____ Cell divisions in meisosis - ✔�... �2 Meiosis occurs in the _______ - ✔✔Ovary or testes DNA replication occurs during ________ - ✔✔Interphase 1 Recombination or 'crossing over' occurs in ________ - ✔✔Prophase 1 Independent assortment of homologous chromosomes occurs in ________ - ✔✔Interphase 1 The DNA condenses, nuclear envelope disintegrates and centrioles move to opposite poles, during ________ - ✔✔Prophase 1 and Prophase 2 The homologous chromosomes pair up during - ✔✔Prophase 1 Individual (single) chromosomes are arranged on the equator during ________ - ✔✔Metaphase 2 The sister chromatids seperate from each other during - ✔✔Anaphase 2 The homologous chromosomes separate from each other during ________ - ✔✔Anaphase 1 New nuclei form and the spindle fibers disintegrate during ________ - ✔✔Telophase 1 and 2 Oogenesis occurs in the ________ - ✔✔Ovaries Spermatogenesis begins at ________ - ✔✔puberty Oogenesis ends at ________ - ✔✔menopause If fertilization occurs, the result of oogensis is - ✔✔1 egg, 2 polar bodies Sperm are very large, mobile, and have a tail called a flagellum. True or False? - ✔✔True Eggs are very large, immobile and don't have a tail. True or False? - ✔✔True A woman can release (Ovulate) millions of eggs in her lifetime. True or False? - ✔✔False Alleles are ________ - ✔✔alternate forms of a gene Mendel counted up ________ in pea plants - ✔✔Phenotypes Whether a trait is dominant or recessive is based on ________ - ✔✔The phenotype of the heterozygote A Genotype that is homozygous means ________ - ✔✔That each allele is the same, ie, AA, aa, BB, bb. When an individual has two different alleles, they are ________ - ✔✔Heterozygous When an individual has two identical alleles, they are ________ - ✔✔Homozygous The appearance of an individual is the ________ - ✔✔Phenotype A test cross is set up to determine: - ✔✔The genotype of the dominant individual If one allele masks (hides) the expression of the other allele, the masked allele is ________ - ✔✔Recessive If a trait is equally as likely to be inherited by males as females, it is ________ - ✔✔autosomal Albinism is an autosomal recessive trait. A man and a woman who are both wild type, have a child with albinism. The genotype of the child can be: - ✔✔aa Albinism is an autosomal recessive trait. A man and a woman who are both wild type, have a child with albinism. The genotype of the mother is: - ✔✔Aa Albinism is an autosomal recessive trait. A man and a woman who are both wild type, have a child with albinism. The probability that their next child is a carrier (heterozygous) is: - ✔✔2/4 Albinism is an autosomal recessive trait. A man and a woman who are both wild type, have a child with albinism. The probability that their next child has albinism is: - ✔✔1/4 Having freckles is an autosomal dominant trait. A man without freckles has a child with a woman has freckles. The woman's mother does not have freckles. The chance that they will have a child with freckles is: - ✔✔2/4 Having freckles is an autosomal dominant trait. A heterozygous couple who both have freckles, have a _____ chance of having a child without freckles: - ✔✔1/4 Pedigrees show the pattern of inheritance of several genetic disorders within a family. True or false? - ✔✔False In pedigrees, squares represent females. True or false? - ✔✔False If the phenotype of the heterozygote is intermediate between the homozygous parents, it is probably an incomplete dominant trait.. True or false? - ✔✔True A blood type A person can donate blood to someone who is blood type AB. True or false? - ✔✔True Helicase: - ✔✔unwinds the DNA double helix Ligase: - ✔✔joins DNA fragments together RNA Primer - ✔✔RNA piece requuired to get DNA Polymerase started This strand discontinuously builds new DNA - ✔✔Lagging Anti-Parralel DNA strands - ✔✔One DNA strand runs 3' to 5' while the other runs 5' to 3' Okasaki fragments - ✔✔short pieces of DNA on the lagging strand DNA polymerase - ✔✔Adds/builds new DNA in a 5' to 3' direction This strand continuously builds new DNA - ✔✔Leading Semi-Converative replication is - ✔✔the new DNA double helix has one old strand and one new strand Complementary DNA base pairing for DNA Replication - ✔✔A-T, C-G Give the complementary sequence of DNA on the opposite strand - and label the 5' and 3' end: 3' CATTAGAAGCTAAAGCGCTATAT 5' - ✔✔5' GTAATCTTCGATTTCGCGATATA 3' Original DNA strand: 5 ' ATACAGATTAACCGG _________________________________ REPLICATION FORK moving to the right Original DNA strand: 3' TATGTCTAATTGGCC ___________________________________ Fill in the leading and lagging strands and label the 5' and 3' ends: - ✔✔Original DNA strand: 5 ' ATACAGATTAACCGG _________________________________ REPLICATION FORK moving to the right 3' TATGTCTAATTGGCC lagging strand ________________ 5 ' ATACAGATTAACCGG leading strand ____________ Original DNA strand: 3' TATGTCTAATTGGCC ___________________________________ Sugar preset in DNA - ✔✔Deoxyribose Type of sugar in RNA - ✔✔Ribose Nitrogenous bases in DNA - ✔✔ACG&T Nitrogenous bases in RNA - ✔✔ACG&U Number of strands in DNA - ✔✔Two Number of strands in RNA - ✔✔One What is the promoter DNA sequence? - ✔✔DNA sequence that is bound by transcription factors What is a Transcription factor? - ✔✔A Protein that binds the promoter region of DNA. What is RNA Polymerase? - ✔✔Builds new RNA in a 5' to 3' direction What is mRNA processing? - ✔✔It's a necessary function that prepares the pre-mRNA for translation (occurs before translation). What is the Coding DNA strand? - ✔✔The pre-mRNA is the same as this sequence, just in RNA form. What is the template DNA strand? - ✔✔The pre-mRNA is complementary to this sequence. What is a poly-A tail? - ✔✔A tail added to the 3' end of mRNA that prevents it from being degraded. What is a G-Cap? - ✔✔A header added to the 5' end of the mRNA that allows it to exit from the nucleus. What is an Intron? - ✔✔Part of DNA sequence that are removed from the pre-mRNA What is an Exon? - ✔✔It's part opf the DNA sequence that are kept in the mRNA. transcribe this section of exon DNA on the Coding strand: 5' GCATGTTCAGGCTAAGCTACCTGTGAC 3' - ✔✔5' GCAUGUUCAGGCUAAGCUACCUGUGAC 3' List all blood types. - ✔✔A, B, AB, O What is a pedigree? - ✔✔A chart that shows a single disorder within a family. On a pedigree, what does a circle mean? - ✔✔Female. On a pedigree, what does a square mean? - ✔✔Male. What is complete/simple dominance? - ✔✔One characteristic is dominant over the opposing one. So, white skin color could be dominant to darker skin color or vice versa. What is incomplete dominance? - ✔✔Where both phenotypes are merged; ie, black cow and white cow have a calf; the calf is grey. Give the genotypes of all blood types. - ✔✔A- Ia Ia or Ia Io B- Ib Ib or Ib Io O- Io Io When does hemolytic disease occur? - ✔✔When a woman is pregnant and their baby is Rh negative. Where and when does replication occur? - ✔✔S1 in Interphase What does gene expression mean? - ✔✔That a gene is specific to tissue, so a liver tissue can't function as a skin gene. Where does Translation occur? What about transcription? - ✔✔Translation- Cytoplasm Transcription- Nucleus What is a codon? - ✔✔Set of three mRNA bases. Give the instructions for translation. - ✔✔1.) Find the 5' end by locating the G-Cap. 2.) Search for 'Aug' start codon. 3.) Set reading prime codons. 4.) Continue, one codon at a time. 5.) Translation ends at a 'Stop' codon 6.) Amino acid chain disengages from mRna and folds into 3-D. What is a simple tip for Translation? - ✔✔Keep all bases, only change T's to U's. What is a Germ-line mutation? - ✔✔mutation that occurs in germ cells. Can be transmitted to progeny and become a good or bad polymorphism in the gene pool. What is a somatic mutation? - ✔✔One mutation that occurs in a body cell that is not passed on to the offspring. What are the two causes of mutation and what are their definitions? - ✔✔Indused: Mutagens such as X-Rays, UV, smoking, etc. Spontaneous: Caused by DNA replication that didn't perform well. List types of mutations. Rank them in order of effect on protein products. - ✔✔Frame Shift: Extremely bad, either done by an insertion mutation or deletion mutation. Either way, this moves all codons by one in either direction. Substitution: Not as bad, just changes a base. Mutations can be positive or negative, give two examples of negative or positive mutations. - ✔✔Positive: Advanced hearing, advanced camouflage. Negative: Blind or bright colored. Name the two events in meiosis that contribute to gene reorganization - ✔✔Cross over/ recombination and Independent assortment. What is the blood type that is the universal receiver, including ABO and Rh? - ✔✔AB pos [Show More]

Last updated: 2 years ago

Preview 1 out of 12 pages