Health Care > EXAM > ASP Final - 76 Questions from Exams all correctly answered (All)

ASP Final - 76 Questions from Exams all correctly answered

Document Content and Description Below

ASP Final - 76 Questions from Exams all correctly answered DNA codes for proteins that have specific functions, the proteins of interest in drug therapy include what? Correct Answer: Receptors, tra... nsporters, metabolizing enzymes The DNA sequencing method with the synonyms "Sanger method" and "chain terminating method" is based on what? Correct Answer: Incorporation of a dideoxynucleotide in the chain Gel electrophoresis relative to strands of DNA can do what? Correct Answer: Separate DNA strands by as little as one nucleoside base In amplification of DNA, what is required to initiate the formation of complementary (or daughter) DNA strands from the template strand? Correct Answer: Primers Why do DNA "chain terminators" stop the expansion of a DNA strand? Correct Answer: They lack the 3' hydroxyl group Strand 1: GCCGTCGTAACGGG Strand 2: ACGGGCTCTGTCAGGTCGTCCA Strand 3: GTCCAGTCGATGGCCTT If the last base in each strand were the terminal base with a fluorescent dye attached, what would the DNA sequence be, once the strands passed through a gel electrophoresis system? Correct Answer: GTA The relative risk of developing stomach cancer from drinking coffee is 1.8 [0.7 to 3.7]. What is the association/correlation between coffee and cancer? Correct Answer: There is no association between coffee and stomach cancer based on this data What is the best measure to compare the outcomes among various different studies to create a level playing field for looking at the results? Correct Answer: Number needed to treat Parametric statistics require 2 assumptions to be utilized appropriately by a researcher. One assumption is that the data must be interval level data. What is the other assumption? Correct Answer: Normally distributed or sample size greater than or equal to 30 The gold standard of OBSERVATIONAL study designs that measures TRUE rate (relative risk) rather than estimating the rate is? Correct Answer: Cohort What is the odds ration an estimate of? Correct Answer: Relative risk [Show More]

Last updated: 2 years ago

Preview 1 out of 14 pages

Buy Now

Instant download

We Accept: