ASP Final - 76 Questions from Exams
all correctly answered
DNA codes for proteins that have specific functions, the proteins of interest in drug
therapy include what? Correct Answer: Receptors, transporters, metaboliz
...
ASP Final - 76 Questions from Exams
all correctly answered
DNA codes for proteins that have specific functions, the proteins of interest in drug
therapy include what? Correct Answer: Receptors, transporters, metabolizing
enzymes
The DNA sequencing method with the synonyms "Sanger method" and "chain
terminating method" is based on what? Correct Answer: Incorporation of a
dideoxynucleotide in the chain
Gel electrophoresis relative to strands of DNA can do what? Correct Answer:
Separate DNA strands by as little as one nucleoside base
In amplification of DNA, what is required to initiate the formation of
complementary (or daughter) DNA strands from the template strand? Correct
Answer: Primers
Why do DNA "chain terminators" stop the expansion of a DNA strand? Correct
Answer: They lack the 3' hydroxyl group
Strand 1: GCCGTCGTAACGGG
Strand 2: ACGGGCTCTGTCAGGTCGTCCA
Strand 3: GTCCAGTCGATGGCCTT
If the last base in each strand were the terminal base with a fluorescent dye
attached, what would the DNA sequence be, once the strands passed through a gel
electrophoresis system? Correct Answer: GTA
The relative risk of developing stomach cancer from drinking coffee is 1.8 [0.7 to
3.7]. What is the association/correlation between coffee and cancer? Correct
Answer: There is no association between coffee and stomach cancer based on this
data
What is the best measure to compare the outcomes among various different studies
to create a level playing field for looking at the results? Correct Answer: Number
needed to treat
Parametric statistics require 2 assumptions to be utilized appropriately by a
researcher. One assumption is that the data must be interval level data. What is the
other assumption? Correct Answer: Normally distributed or sample size greater
than or equal to 30
The gold standard of OBSERVATIONAL study designs that measures TRUE rate
(relative risk) rather than estimating the rate is? Correct Answer: Cohort
What is the odds ration an estimate of? Correct Answer: Relative risk
[Show More]