Electrophoresis Lab Report
Instructions: In this lab activity, you will examine the DNA evidence from the crime scene to
determine what may have happened to the victim. Using electrophoresis, you will create a DNA
“fi
...
Electrophoresis Lab Report
Instructions: In this lab activity, you will examine the DNA evidence from the crime scene to
determine what may have happened to the victim. Using electrophoresis, you will create a DNA
“fingerprint” for each DNA sample in order to compare all samples more easily. Submit your
lab report to your instructor when completed.
Title:
Objective(s):
Introduction-Restriction Enzymes
Scientists use restriction enzymes for many purposes. In the field of forensic science, they are
used to cleave and analyze DNA structure to identify an individual suspected of a crime.
Restriction enzymes digest DNA by cutting the molecule at specific locations called restriction
sites. These sites consist of a four- to 10-nucleotide base pair (bp) called a palindrome — a
sequence of DNA nucleotides that reads the same from either direction. Restriction enzymes cut
DNA strands between two bases within this palindrome. A cut exactly in the center of the
restriction site can create blunt ends. Cuts in other locations within the palindrome can create a
single-stranded overhanging piece or “sticky” end of unpaired nucleotides.
Many processes using biotechnology depend on combing DNA fragments from different sources.
Another enzyme, DNA ligase, can bond two pieces of DNA together when they are cut with the
same restriction enzyme.
Introduction-Restriction Enzymes Reflection Questions
1. You have a piece of DNA with the following template strand: 5’-
ATCGAATTCGTCGCTGAATTCGCCTAACTCCCGTGCCTATATATGGAATTC
GCT-3’
a) What is the sequence of the complementary DNA strand? Type it below.
b) If you were creating a complementary strand of RNA instead, how would it
differ from the DNA strand?
c) How is DNA structure and composition different from RNA?
2. The DNA strand above is cut with a restriction enzyme at the restriction site 5’-
GAATTC-3’. The enzyme makes a staggered cut between the two T’s of the
[Show More]