Biology > QUESTIONS & ANSWERS > BIO206 QUIZ WITH ANSWERS HIGHLIGHTED (All)

BIO206 QUIZ WITH ANSWERS HIGHLIGHTED

Document Content and Description Below

How many different amino acids could be coded for using the synthetic mRNA sequence of 5' UGCUGCUGC 3' ? A. 0 B. 1 C. 2 D. 3 E. 4 2. Nonsense codons are A. codons that code for multiple amino ac... ids. B. codons that do not code for an amino acid. C. codons that can be read forward or backward. D. start codons. 3. The enzyme that makes RNA from a DNA template is A. RNA‐dependent DNA polymerase. B. DNA‐dependent DNA polymerase. C. DNA‐dependent RNA polymerase. D. RNA‐dependent RNA polymerase. E. Reverse‐transcriptase 4. In the modification of eukaryotic mRNA, a "cap" consisting of a/an _________ and a tail consisting of _______ are usually added to the transcript. A. acetyl group, multiple cytosines B. multiple guanines, methyl group C. multiple thymines, acetyl group D. methyl group, multiple adenines 5. A bacterial (prokaryotic) ribosome is composed of ______ subunits. A. 20S and 40S B. 30S and 50S C. 40S and 60S D. 50S and 70S 6. A mutation that is characterized by a change in the DNA sequence, but no change in the resulting protein sequence, is called A. frameshift mutation. B. missense mutation. C. silent mutation. D. nonsense mutation. E. deletion mutation. 7. After digestion of DNA with a restriction endonuclease, which statement is true about the resulting DNA fragments? A. They will have either a single stranded overhang or blunt ends, depending on the enzyme used. B. They will have only blunt ends. C. They will have only single stranded overhangs. D. The result cannot be predicted because a single restriction enzyme can generate either single stranded overhangs or blunt ends. 8. The role of the DNA polymerase in Sanger sequencing is to synthesize A. a copy of the template strand in the 5' to 3' direction. B. the template strand in the 3' to 5' direction C. a copy of the template strand in the 3' to 5' direction. D. the template strand in the 5' to 3' direction 9. How could PCR be used for the detection of a SNP? A. PCR coupled with Southern blotting using one of the primers as a probe. B. The PCR reaction would need to be sequenced. C. The PCR reaction could be subjected to agarose gel electrophoresis to determine the presence and size of the fragment. D. If a fragment is amplified then the SNP is present, no other techniques would have to be used 10. How many introns are present on a gene that consists of 4 exons? A. 2 B. 3 C. 4 D. 5 E. The number cannot be determined from the information provided. 11. The sequence of nucleotides below is found in a single‐stranded DNA template: ATTGCCAGATCATCCCAATAGAT A. Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5′ and which end is 3′? Solution: RNA is synthesized in a 5′ to 3′ direction by RNA polymerase, which reads the DNA template in a 3′ to 5′ direction. So, if the polymerase is moving from left to right on the template then the 3′ end must be on the left and the 5′ end on the right. 3′–ATTGCCAGATCATCCCAATAGAT–5′ B. Give the sequence and label the 5' and 3' ends of the RNA copied from this template. Solution: 5′–UAACGGUCUAGUAGGGUUAUCUA–3′ 12. Four different uracil auxotrophs of Neurospora, a eukaryotic mold, are tested for growth on uracil and uracil precursors. The data are shown in the following table. A plus sign (+) means growth. Diagram the uracil pathway, showing the step at which each mutant is blocked. [Show More]

Last updated: 2 years ago

Preview 1 out of 2 pages

Buy Now

Instant download

We Accept:

We Accept
document-preview

Buy this document to get the full access instantly

Instant Download Access after purchase

Buy Now

Instant download

We Accept:

We Accept

Reviews( 0 )

$8.00

Buy Now

We Accept:

We Accept

Instant download

Can't find what you want? Try our AI powered Search

169
0

Document information


Connected school, study & course


About the document


Uploaded On

Aug 02, 2022

Number of pages

2

Written in

Seller


seller-icon
STUDY-GUIDENOTES

Member since 4 years

164 Documents Sold

Reviews Received
20
8
1
1
4
Additional information

This document has been written for:

Uploaded

Aug 02, 2022

Downloads

 0

Views

 169

Document Keyword Tags

More From STUDY-GUIDENOTES

View all STUDY-GUIDENOTES's documents »

$8.00
What is Scholarfriends

In Scholarfriends, a student can earn by offering help to other student. Students can help other students with materials by upploading their notes and earn money.

We are here to help

We're available through e-mail, Twitter, Facebook, and live chat.
 FAQ
 Questions? Leave a message!

Follow us on
 Twitter

Copyright © Scholarfriends · High quality services·