How many different amino acids could be coded for using the synthetic mRNA sequence of 5' UGCUGCUGC 3' ? A. 0 B. 1 C. 2 D. 3 E. 4 2. Nonsense codons are A. codons that code for multiple amino acids. B. codons tha
...
How many different amino acids could be coded for using the synthetic mRNA sequence of 5' UGCUGCUGC 3' ? A. 0 B. 1 C. 2 D. 3 E. 4 2. Nonsense codons are A. codons that code for multiple amino acids. B. codons that do not code for an amino acid. C. codons that can be read forward or backward. D. start codons. 3. The enzyme that makes RNA from a DNA template is A. RNA‐dependent DNA polymerase. B. DNA‐dependent DNA polymerase. C. DNA‐dependent RNA polymerase. D. RNA‐dependent RNA polymerase. E. Reverse‐transcriptase 4. In the modification of eukaryotic mRNA, a "cap" consisting of a/an _________ and a tail consisting of _______ are usually added to the transcript. A. acetyl group, multiple cytosines B. multiple guanines, methyl group C. multiple thymines, acetyl group D. methyl group, multiple adenines 5. A bacterial (prokaryotic) ribosome is composed of ______ subunits. A. 20S and 40S B. 30S and 50S C. 40S and 60S D. 50S and 70S 6. A mutation that is characterized by a change in the DNA sequence, but no change in the resulting protein sequence, is called A. frameshift mutation. B. missense mutation. C. silent mutation. D. nonsense mutation. E. deletion mutation. 7. After digestion of DNA with a restriction endonuclease, which statement is true about the resulting DNA fragments? A. They will have either a single stranded overhang or blunt ends, depending on the enzyme used. B. They will have only blunt ends. C. They will have only single stranded overhangs. D. The result cannot be predicted because a single restriction enzyme can generate either single stranded overhangs or blunt ends. 8. The role of the DNA polymerase in Sanger sequencing is to synthesize A. a copy of the template strand in the 5' to 3' direction. B. the template strand in the 3' to 5' direction C. a copy of the template strand in the 3' to 5' direction. D. the template strand in the 5' to 3' direction 9. How could PCR be used for the detection of a SNP? A. PCR coupled with Southern blotting using one of the primers as a probe. B. The PCR reaction would need to be sequenced. C. The PCR reaction could be subjected to agarose gel electrophoresis to determine the presence and size of the fragment. D. If a fragment is amplified then the SNP is present, no other techniques would have to be used 10. How many introns are present on a gene that consists of 4 exons? A. 2 B. 3 C. 4 D. 5 E. The number cannot be determined from the information provided. 11. The sequence of nucleotides below is found in a single‐stranded DNA template: ATTGCCAGATCATCCCAATAGAT A. Assume that RNA polymerase proceeds along this template from left to right. Which end of the DNA template is 5′ and which end is 3′? Solution: RNA is synthesized in a 5′ to 3′ direction by RNA polymerase, which reads the DNA template in a 3′ to 5′ direction. So, if the polymerase is moving from left to right on the template then the 3′ end must be on the left and the 5′ end on the right. 3′–ATTGCCAGATCATCCCAATAGAT–5′ B. Give the sequence and label the 5' and 3' ends of the RNA copied from this template. Solution: 5′–UAACGGUCUAGUAGGGUUAUCUA–3′ 12. Four different uracil auxotrophs of Neurospora, a eukaryotic mold, are tested for growth on uracil and uracil precursors. The data are shown in the following table. A plus sign (+) means growth. Diagram the uracil pathway, showing the step at which each mutant is blocked.
[Show More]