Biology > QUESTIONS & ANSWERS > BIOD 151 Meiosis & Mitosis Exam 2022 | BIOD151 Meiosis & Mitosis Exam - Grade A (All)

BIOD 151 Meiosis & Mitosis Exam 2022 | BIOD151 Meiosis & Mitosis Exam - Grade A

Document Content and Description Below

Test Answers While watching a single cell divide, you notice that it has produced two daughter cells which then divide to produce a total of four cells. Each of those four cells is genetically ident... ical to the original single cell. Have you observed mitosis or meiosis? mitosis In a cell there are 20 double stranded chromosomes. How many chromatids are there? 40 Meiosis produces daughter cells which are diploid. FALSE The haploid number contains two chromosomes of each kind. FALSE Sex cells are diploid. FALSE The diploid number in humans is 46 A cell has 36 chromosomes. After it divides by mitosis, how many chromosomes will be in each cell? 36 Occurs only to produce new offspring Meiosis Two division cycles meiosis No crossing-over occurs mitosis Four daughter cells are produced meiosis Produces cells which are not genetically identical to the parent meiosis This study source was downloaded by 100000831988016 from CourseHero.com on 04-14-2022 14:58:55 GMT -05:00 https://www.coursehero.com/file/36099809/Meiosis-Mitosisdocx/ Microtubules attach to each centromere. metaphase New nuclear membranes form. telophase Chromatids separate and move toward opposite poles. anaphase The nuclear membrane breaks down. prophase The number of homologous pairs in humans is 22 Each homologous pair is made of chromosomes of different lengths. FALSE Homologous pairs are found in a human sperm cell. FALSE Homologous pairs have their centromeres at the same site. TRUE During crossing-over, homologous pairs exchange genetic material. TRUE Based upon what you know from the module, explain why siblings with the same biological parents are not identical. Crossing over of genetic material occurs between chromosomes during meiosis 1 (prophase 1) to make for more diversity amongst offspring. What is the benefit of sexual reproduction occurring via meiosis as opposed to mitosis? Meiosis allows for variability amongst the offspring allowing for adaptations to occur over time. Is shaped like a ladder DNA Contains the codon This study source was downloaded by 100000831988016 from CourseHero.com on 04-14-2022 14:58:55 GMT -05:00 https://www.coursehero.com/file/36099809/Meiosis-Mitosisdocx/ RNA Is double stranded DNA Can move from the nucleus to the ribosomes RNA Contains thymine DNA Within the following sequence of codons, there is ONE polypeptide chain. Write out the codons in order that comprise the polypeptide chain. To receive full credit you must begin and end with the correct codons. AAUCAUAUGGCUAAAGCGUGA AUGGCUAAAGCGUGA – AUG (start codon) a [Show More]

Last updated: 2 years ago

Preview 1 out of 4 pages

Buy Now

Instant download

We Accept: