BioBeyond Unit 6: Making Proteins

BioBeyond Unit 6: Making Proteins Where are the "instructions" for cellular function stored? - ✔✔Nucleic acids Let's review - what are some functions of nucleic acids? - ✔✔Store information Speed up reactions Transpo ...

BioBeyond Unit 6: Making Proteins Where are the "instructions" for cellular function stored? - ✔✔Nucleic acids Let's review - what are some functions of nucleic acids? - ✔✔Store information Speed up reactions Transport information blue C NH2 - ✔✔Base darker green O - ✔✔Sugar Light green P-O - ✔✔Phosphate Complementary sequence from bottom to top (enter letters only - no spaces or punctuation): - ✔✔ATCG What holds the two strands together? - ✔✔Hydrogen bonds Where do you think the information is encoded? - ✔✔The sequence/order of bases Produces free proteins - ✔✔Ribosome E Yes Protects genetic material - ✔✔Nucleus A No Produces proteins to be excreted - ✔✔Endoplasmic Reticulum B No How do you think the information from the DNA (that is needed to make proteins) gets to the ribosomes? - ✔✔The information is copied to another molecule which goes from DNA to ribosome How do you think prokaryotic genetic information gets to the ribosomes? - ✔✔The information is copied to another molecule which goes from DNA to ribosome What differences do you see? Select all that apply. - ✔✔The structure of the nitrogenous base is different The structure of the sugar is different What differences do you see between these bases? Select all that apply. - ✔✔The number of carbon atoms is different The groups connected to the rings are different The number of hydrogen atoms is different What do you recall are the normal base pairs in DNA? Select all that apply. - ✔✔C-G A-T An adenine (A) in DNA bonds with - ✔✔U A cytosine (C) in DNA bonds with - ✔✔G A guanine (G) in DNA bonds with - ✔✔C A thymine (T) in DNA bonds with - ✔✔A Thinking about how DNA is normally stored in cells, what has to be done to the DNA before messenger RNA can be made? Select all that apply. - ✔✔It has to be unwound The hydrogen bonds between bases have to be broken mRNA Sequence: - ✔✔UUAGCGGCUUAUGGCUAAUGUGGCC Which of the following is the most likely reason the second strand is evolutionarily conserved? - ✔✔The second strand provides stability and redundancy for DNA How many different possibilities are there for a single base in mRNA? It may help to write them out using the single letter codes above. - ✔✔4 Are there enough possibilities to make the 20 different amino acid combinations using a single base? - ✔✔No What if mRNA used a group of two bases to store the information? How many different possibilities are there for a group of two bases in mRNA? It may help to write them out using the single letter codes above. For example, a pair of bases could be AA, AU, AG, AC, and so forth - ✔✔16 Are there enough possibilities to make the 20 different amino acid combinations using two bases? - ✔✔No The table below will help you determine how many combinations are possible for three bases. Fill in each combination below. top to bottom and left to right - ✔✔UUC UAA UCG CGC CUG ACC AGC AUG GAU GGA Where do you think it is least likely for an error to change the amino acid encoded? - ✔✔Third position In which organelle, in both prokaryotes and eukaryotes, does this process occur? - ✔✔Ribosome From this diagram, what characteristics can you observe about the structure of the ribosome? Select all that apply. - ✔✔It is made of two pieces of different size. The mRNA binds between pieces of the ribosome. Only one piece of the ribosome has places inside of it where polypeptides are built. Molecules aside from the ribosome and mRNA are needed to make polypeptides. What would the anticodon sequence of this tRNA molecule be to ensure bonding to the mRNA sequence AUG? - ✔✔UAC Using what you see in the animation, put the steps of translation in order below Top to bottom - ✔✔First tRNA bonds and ribosome assembles around mRNA A new tRNA enters the ribosome Polypeptide binds to newest tR