Health Care > EXAM > ASP Final - 76 Questions from Exams all correctly answered (All)

Also available in bundle ( Click Here )

ASP Final - 76 Questions from Exams all correctly answered

Document Content and Description Below

DNA codes for proteins that have specific functions, the proteins of interest in drug therapy include what? Receptors, transporters, metabolizing enzymes The DNA sequencing method with the synon... yms "Sanger method" and "chain terminating method" is based on what? Incorporation of a dideoxynucleotide in the chain Gel electrophoresis relative to strands of DNA can do what? Separate DNA strands by as little as one nucleoside base In amplification of DNA, what is required to initiate the formation of complementary (or daughter) DNA strands from the template strand? Primers Why do DNA "chain terminators" stop the expansion of a DNA strand? They lack the 3' hydroxyl group Strand 1: GCCGTCGTAACGGG Strand 2: ACGGGCTCTGTCAGGTCGTCCA Strand 3: GTCCAGTCGATGGCCTT If the last base in each strand were the terminal base with a fluorescent dye attached, what would the DNA sequence be, once the strands passed through a gel electrophoresis system? GTA The relative risk of developing stomach cancer from drinking coffee is 1.8 [0.7 to 3.7]. What is the association/correlation between coffee and cancer? There is no association between coffee and stomach cancer based on this data What is the best measure to compare the outcomes among various different studies to create a level playing field for looking at the results? Number needed to treat Parametric statistics require 2 assumptions to be utilized appropriately by a researcher. One assumption is that the data must be interval level data. What is the other assumption? Normally distributed or sample size greater than or equal to 30 The gold standard of OBSERVATIONAL study designs that measures TRUE rate (relative risk) rather than estimating the rate is? Cohort What is the odds ration an estimate of? Relative risk What is a study that reflects more of the real world setting and includes patients with more than one disease state? Effectiveness study When will you not float at the surface of a fresh water lake? When your average body density is less than the density of fresh water A neuron star has a mass of 2.50 x 10^28 kg and a density of 3.93 x 10^18 kg/m^3. What is its volume? 6.36 x 10^9 m^3 You are lying down on a bed of 3000 nails (I'm not sure why). Your body weight of 695 N is evenly distributed among the nails. Each nail has a tip diameter of 1.00 nm. What is the pressure at each nail point? 2.95 x 10^5 Pa For a hydraulic lift in a car garage designed to lift up a car using a relatively small input force, what must be true about the force and pressure on the input versus the output piston? The force on the input piston is less than the force on the output piston. The pressure on the input piston is equal to the pressure on the output piston. What is Archimedes' principle? An object submerged (partially or wholly) in a fluid experiences an upward buoyant force. The buoyant force is equal in magnitude to the weight of the fluid displaced by the object. [Show More]

Last updated: 2 years ago

Preview 1 out of 13 pages

Buy Now

Instant download

We Accept: