MB ASCP QUESTIONS AND ANSWERS
SCORED A+
What genes would be screened in a lung cancer panel? ✔✔KRAS, EGFR, ALK
In a retrovirus, the RNA acts as: ✔✔Genome and mRNA
To what does the AcrAB gene product create resistance
...
MB ASCP QUESTIONS AND ANSWERS
SCORED A+
What genes would be screened in a lung cancer panel? ✔✔KRAS, EGFR, ALK
In a retrovirus, the RNA acts as: ✔✔Genome and mRNA
To what does the AcrAB gene product create resistance to? ✔✔Tetracycline
What gene is measured following the treatment with imatinib(Gleevec)? ✔✔BCR/Abl
Blood drawn into what type of tube is compatible for genetic testing? ✔✔K2-EDTA tube
Primer dimers are due to what complimentary issue? ✔✔3' to 3' complementarity of primer pairs
Microsatellite instability is best described as: ✔✔Contraction or expansion of the genomes caused
by frameshift mutations (deletions or insertions) in elements of the genome consisting of a
repeating sequence of 1-3 base pairs
How many hydrogen bonds are formed between one C:G base pair? ✔✔3
When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes them
✔✔Ligase
What assay amplifies the target using DNA ligase? ✔✔LCR
What genes would be screened in a breast cancer panel? ✔✔HER2, ERBB2, BRCA1
What factors can affect nucleic acid hybridization? ✔✔G:C ratio of bases
pH of the hybridization reaction
Hybridization temperature
Both parents are carriers of an autosomal recessive disorder. What percent chance do these parents
combined have to pass down this affected gene to their child? ✔✔75%
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization
procedure. What is the melting temperature, Tm, of the sequence? ✔✔58*C
The enzyme that primes DNA synthesis is: ✔✔DNA primase
Splicing is the process that: ✔✔Removes introns and preserves exons
All of the following enzymes are part of the DNA replication machinery ✔✔Ligase, DNA
polymerase, Helicase
This translocation creates a fusion protein between the Abl1 gene on one chromosome and the
BCR gene on the other chromosome, resulting in chronic myelogenous leukemia (CML):
✔✔t(9;22)
Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate
sense strand? ✔✔5'-ATCTATGTCGGCAATT-3'
All of the following methods of amplification are considered target amplification: ✔✔Quantitative
PCR
Strand Displacement Amplification
Reverse Transcriptase PCR
What stain binds to minor groove of DNA Duplex? ✔✔SYBR1
The purines are: ✔✔Adenine and guanine
Purines and pyrimidines differ from each other in that: ✔✔Purines have two rings; pyrimidines
have one ring
What gene is measured following treatment with Warfarin? ✔✔VKORC1
According to Chargaff's rule of base pairing, adenine pairs with: ✔✔Thymine
When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen as
approximately: ✔✔ΔCt = 3.3
The process of making RNA is termed: ✔✔Transcription
When sequencing HLA-DR what is targeted? ✔✔Exon 2 of the β subunit
All of the following are components of nucleic acids: ✔✔Phosphate group
Sugar (ribose or deoxyribose)
Nitrogenous base (A,C,G,T)
Branched DNA amplification (bDNA) is best classified as: ✔✔Signal amplification
This PCR method works by generating a signal at the annealing step (i.e. when the probe binds its
target) of the PCR reaction: ✔✔Molecular beacons
What is the predominant form of DNA? ✔✔B form
Mantle cell lymphoma (MCL) is caused by what translocation? ✔✔t(11;14)
What responds poorly to Ribavarin/Interferon treatment? ✔✔HCV type 1 & 4
The sugar in DNA is: ✔✔Deoxyribose
Why is it critical to maintain workflow from "clean" to "dirty" while working in a molecular lab?
✔✔To avoid contamination of specimens with amplified product which create false positive
results
Which two HPV types are responsible for most cases of cervical cancer? ✔✔16 and 18
The amelogenin locus, found on the sex chromosomes, is used in gender identification.
Amplification at this locus reveals 2 peaks of sizes 212 and 218 base pairs. If this amplification
were part of a gender identification procedure, what would be the gender of the individual?
✔✔Male
This restriction enzyme "digests and removes a methyl group from Adenine": ✔✔Type I
To what does the mecA gene product create resistance to? ✔✔Penicillin
3 cerebrospinal fluid (CSF) tubes labeled 1 through 3 have arrived in your clinical laboratory for
evaluation. The tubes were numbered in the order in which they were obtained, with #1 being the
first tube collected and #3 being the last tube collected. What is the best explanation for a
macroscopic appearance seen in the CSF? ✔✔A traumatic tap
Next Generation Sequencing set-up require: ✔✔Libr
[Show More]