MB (ASCP) 2022 Questions and Answers Rated A

MB (ASCP) 2022 Questions and Answers Rated A Consider the table below where a child and a possible father (PF) share the listed paternity indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Locus Tested P ...

MB (ASCP) 2022 Questions and Answers Rated A Consider the table below where a child and a possible father (PF) share the listed paternity indices for each locus listed (LOC-A1, LOC-B2, LOC-C3, LOC-D4). Locus Tested PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 15/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table, what is the combined paternity index, CPI, from the loci tested: LOC-A1, LOC-B2, LOC-C3 and LOC-D4? 12.42 9.558 15.56 2.38 12.42 ( CPI is calculated by multiplying all Paternity index tgt) Best way to avoid PCR contamination Separate Pre-PCR (clean area) and post PCR (dirty area) A260=1.4, A280=1.1 . protein contamination or Rna contam or useable RNA Protein contamination . A260/280 = 1.3 <1.6 = protein contamination, 1.7-2.0 = good DNA, 1.9-2.0 = good RNA Why is Fluorometry a better technique that Spectroscopy Increased sensitivity and more importantly can accurately measure DNA concentration of a structurally intact double stranded DNA molecule Linkage Disequilibrium LD is the non random association of alleles at 2 or more loci in a general population. When alleles are in LD, haplotypes do not occur at the expected frequencies. Specificity Specificity = TN / (TN + FP) Limit of Detection (LOD) lowest concentration of analyte that can be detected mRNA Sequence provided - Convert it into DNA (Template/Anti-sense Strand) [Replace U with T] Correct order of HIV Sample Preparation Workflow Plasma Preparation RNA Extraction RNA Amplification/Modification Procedure If a flask of cells is provided for the intended purpose of DNA isolation, how would you proceed further Trypsinize and/or scrape the cells inside the provided flask, collect the cells suspended in the media, spin, and then proceed further Which end of the primer is critical for the increased specification of PCR Amplification process 3'End of the Primer Primer Dimer Complementarity 5' End of the Primers (3-3' Was not an option) Mechanism of Action of MecA Gene in MRSA Altered Drug Target (PBP2A) Technique to be used for FFPE Cervical Tissue Provided Invader Assay (Non-Amplification Method) Liquid Based-Cytology Useful for what kind of virus HPV is the correct answer (Options Provided for: HIV, HBV, HCV, HPV) Isothermal Method that utilizes Primes and Polymerase to Create Synthetic dsDNA SDA (Strand Displacement Amplification) Polymerase used in Isothermal LAMP Procedure BST (Bacillus Stearothermophilus) BRAF V600E Mutation is Associated with Lynch Syndrome (Also Known as HNPCC) CAP Requires Discontinued SOP/Procedures to be stored for how long At least 2 years from the date of discontinuation CAP Requires Laboratory Personnel (Technologist) Proficiency Testing Once a Year Most Important Component of Clinical Laboratory Completed Validation Studies Final Test Validation Summary Signed off by Laboratory Director STR Electropherogram provided and select the most informative loci Two different alleles each was both recipient vs donor the most informative one STR makes use of which of the following Variable Nucleotide Experiment Performed (RFLP + PCR + Gel Electrophoresis): three bands observed in the mutant sequence as compared to the normal sequence Insertion of New Restriction Site Mutation in what gene decreases metabolism of Irinotecan Drug UGT1A1 CYP2D6 Enzyme Metabolizes what drug Codeine Determine Melting Temperature of a given DNA Sequence 2(A+T) + 4(G+C) Specimen Collection for Testing of Cystic Fibrosis Either 1 ml EDTA Lavender Tube/5 ml ACD Tube (Not Sure: I think I answered 1 ml EDTA, however the volume seems to be too low) Fish is used in Prader Willi Syndrome Defects associated with Prader Willi Syndrome Uniparental Disomy and Genomic Imprinting - Paternal Chromsome Deletion 15 Which of the Following is Trinucleotide Repeat Expansion Disorder Huntington's Disease, Fragile X HER2/EGFR2 Overexpression Trastuzumab Therapy Overexpression of estrogen, so treat with Herceptin/Tamoxifin Trastuzumab therapy T-Cell Receptor Gene Rearrangement Hodgkin Lymphoma (PS: Don't get confused with T-Cell Lymphoma that corresponds to Sezary Syndrome, both options will be present for confusion) Genes Involved in the Cell Cycle Process are termed as Cycle-Dependent What is TP53 Tumor Suppressor Gene PML/RARA Fusion occurs in which Leukemia AP (Bit Strange 2 questions on the same leukemia) Acute Promyleocytic Lekemia (APL) Translocation Corresponds to t(15;17) BAM/SAM Files Purpose Contains the Sequenced Aligned Data How to run multiple unknow samples in a simple NGS Run Barcoding the Samples Indexing is performed in NGS To Barcode/Label/Tag DNA Sample of Interest Ideal Workflow Next Generation Sequencing (NGS) Fragmentation-End Repair-Adapter Ligation What prevents/quenches the Fluorescent (Report Dye) Signal in a Taq Man Probe G On 3' End A List of PCR Components for PCR Reaction Mix Provided (Determine which component is excess): DNA Polymerase Concentration needs to be reduced to 2.5-3 units - Taq Polymerase Conc was provided as 100 Units as compared to other PCR Components How to Preferentially amplify short DNA Fragments Increase KCL Concentration Degenerate Primer Sets MultiPlex PCR What PCR increases Specificity and sensitivity of a low copy number target in a patient sample Nested PCR Pressure in pre-area and post-area PCR Pre - Positive pressure Post - Negative pressure Bake Glassware to be used for RNA Isolation Procedure 250 C For 4 Hours (However Book States 4-6 Hours at 400 C) Isochromosomes Long Arms Term for abnormal number of chromosomes in a cell. For example a human cell having 45 or 47 chromosomes instead of the usual 46. Aneuploidy ( A cell with any number of complete chromosome sets is called a euploid cell.) Nucleic Acid Dyes that binds to minor groove of Double Helix DNA SYBR Green Addition of Agarose in Gel Slows the migration by 15% Polyacrylamide Neurotoxin (Acrylamide Neurotoxin in Gel) Codon (Nucleotide) + Amino Acid Code + Name of the Amino Acid Provided + Identify the Kind of Mutation Frame Shift Mutation (Shifts the Frame) Non-Sense Mutation Interaction between DNA/Histones Hydrophobic Interactions Type of RNA that controls Gene Expression, protein synthesis, Cell Development and Eukaryotic Cell Defense miRNA mRNA Stability & Half-life 3' Poly A Tail (5' Methylated G Cap was not an option) Type of RNA that serves as template for Transcription Process Template (Anti sense Strand) Eukaryotic DNA Polymerase for Leading Strand δ (Delta) Eukaryotic DNA Polymerase for Repair ε (Epsilon) - (Since Beta {β} Polymerase was not an option) How many SNPS are there? 10^7 or 11 bilion How to create synthetic dsDNA? SDA Culture of fibroblasts? Trypsin and scrape Monitoring HIV circulating in patient's plasma using NASBA HIV genome is RNA, so only NABSA would allow direct detection What is a metagenome? sum total of all DNA sequenced from an environmental sample What gel to use for 200-300 base pairs? 0.5 agarose or 8% polyacrylamide (Pulse Field >25000bp PAGE 5-500 bp Agarose 200-30000bp) What does G574* mean? Termination after the G How to store RNA for more than 6 months? Ethanol -70C How to check for HER2? FISH What causes smearing in gel (high/low dye concentration, high low voltage) High voltage Improperly prepared gel: If the gel is not poured correctly, it will not polymerize or solidify evenly, thus causing the molecules to smear. If the wells are filled too much, or if the sample is not properly diluted, the excess sample may smear across the gel. Also DNA degradation. What is associated with multiple mutations and large deletions DMD (Duchenne Muscular Dystrophy) _Dystrophin gene IQCP is most associated with risk assessment Is Linkage Disequilibrium to nonrandom association of FAR or NEAR loci? Near. (Linkage Disequilibrium occurs when 2 alleles are Close in the same chromosome. Linkage Equilibrium occurs when 2 alleles are Far apart in the same chromosome) Example of ISOTHERMAL SIGNAL amplification? Technique employs the signal amplification resulting from probe: target hybridization rather than by amplifying the target or the probe? bDNA / bDNA analysis want to PCR HLA-D Beta Exon 2 HCV most conserved 5'UTR Mantle (MCL) t (11;14) Histones Ionic HER2 overexpression Treatment with Traustmaub What is FLT3 associated with? AML HFE C282Y, H63D, S65C Acute Promylocytic Leukemia (APL) t(15;17) Something about getting quality of RNA? Choices were all 3 letter acronym with R, like RFN, RIN The RNA integrity number (RIN) is an algorithm for assigning integrity values to RNA measurements. The integrity of RNA is a major concern for gene expression studies and traditionally has been evaluated using the 28S to 18S rRNA ratio, a method that has been shown to be inconsistent. Amplification method with polymerase creating a synthetic dsDNA TBC Identical twins for organ donor what should you do? continue with assay, tell supervisor, something about parents? Why does NGS use fluorescence over spectrometry? Fluorescence is more sensitive because of the different ways of measuring absorbance and fluorescence. Light absorbance is measured as the difference in intensity between light passing through the reference and the sample. In fluorescence the intensity is measured directly, without comparison with a reference beam. Similarities between NGS and CE/Sanger •DNA polymerase incorporates fluorescently labeled dNTPs into a DNA template •The newly incorporated nucleotides are identified by fluorophore excitation. MALDI-Tof Matrix-Assisted Laser Desorption/Ionization-Time Of Flight (MALDI-TOF) Mass Spectrometry (MS) is a common method used for quality control (QC) of oligonucleotides. MALDI-TOF instrumentation is suitable for use in high-throughput industrial QC settings and can resolve molecules in the size range of oligonucleotides Heteroduplex are dsDNA complexes - consisting of two partly mismatched polynucleotide strands derived from two different parent molecules. (look up Denaturing HPLC) Benefits of NGS Output Reads are relatively short, but so much more is produced (100K-1 Billion) creating a huge amount of data for very little cost First time Real -Time PCR test perform, West Nile and HSV of CSF were negative after 10 days. Test repeated and HSV is now weak positive. Why? Case series and studies have shown that HSV polymerase chain reaction (PCR) can be falsely negative, especially among children and early in the disease course. If testing first LP is negative and herpes simplex encephalitis (HSE) is still of concern, a second LP should be repeated within 3-7 days with CSF sent for HSV PCR. Perfect PCR conditions, 5ng/mL DNA used produces faint read, how to increase the read? First check your programming for each step of PCR cycle as the faint bands are due to several reasons like insufficient number of your cycles, low extension time, low annealing time, increased annealing temperature, decreased denaturing temperature, high or low denaturation time. How a TaqMan probe should look Flourophore / Quencher Prob hydrolyzation and release of quencher (hybridizes to target, then cleaved to release signal) For FDA-approved assay, each lab has to determine their own Accuracy, precision, specificity or sensitivity. Need to choose only 3 of them. Why preferred NGS over Sanger seq. NGS: detect large deletion by-Paired end read. what is the most conserved region of the HCV virus 5′UTR Genomic Region storage of HIV sample prior to extraction Place the cryovials in a cardboard freezer box with a partitioned insert. If the specimens are to be transported to the testing laboratory, store the specimens at 4-8 °C for up to a maximum of 1 week. For longer-term storage, the specimens should be frozen at -20 °C or below. nonpolar amino acids FILM WAV: phenylalanine, isoleucine, leucine, methionine, tryptophan, alanine, valine Which virus can be tested by liquid-based cytology? ● HIV ● HBV ● HCV ● HPV HPV Genetic imprinting Occurs when the expression of a gene has different effects depending on whether the mother or the father passed on the gene Epigenetics the study of environmental influences on gene expression that occur without a DNA change Warfarin (Coumadin) VKorC1, CYP2C9 (Treats thrombosis (Factor V Leiden, Prothrombin)) Palindrome a word or phrase that reads the same backward as forward Writing primer forward/reverse sequences Forward: Start writing complimentary strand for 3'-5' strand (about 20nt and end at G-C) => got forward primer 5'-3' Reverse: 20 complimentary nt to 5'-3' strand from 3'- 5' direction. Then rewrite the primer to 5' to 3' RFLP a variation in the length of restriction fragments produced by a given restriction enzyme in a sample of DNA. Such variation is used in forensic investigations and to map hereditary disease. NGS steps 1. Prepare genomic DNA sample. Randomly fragment DNA and ligate adapters onto end of DNA 2. Attach DNA to surface. Bind single stranded fragments randomly to the inside surface of the flow cell channel. 3. Bridge Amplification. Added unlabeled nt & enzyme to initiate solid-phase bridge amplification. 4. Fragments become double stranded. Enzyme incorporated nt build ds briges 5. Denature ds molecular denaturation leaves ss templates. 6. Complete Amplification. Several million dense clusters of ds DNA are generated in each channel of the flow cell. 7. First chemistry cycle: determine first base. Add 4 labeled reversible terminators, primers, and DNA polymerase enzyme to flow cell. 8. Image first base: capture image of fluorescence after excitation and record identity of each cluster. Excitation removes allylyl group allowing next nt to bind 9: repeat 7 and 8 Detection of HPV from FFPE cervical cancer HPV testing is mainly performed using dry swabs, liquid-based cytologies, but also formalin-fixed paraffin-embedded (FFPE) biopsies. The FFPE specimens are taken from selected target regions of the cervical epithelium, allowing detection of HPV genotypes through DNA analysis Replication forks, origins of DNA replication, are created by this enzyme Helicase The sugar in DNA is: Deoxyribose mRNA, after its synthesis from DNA by RNA polymerase, undergoes what is termed posttranscriptional changes. All of the following are considered post-transcriptional modifications, EXCEPT: A. Capping: the addition of 7-methylguanosine to the 5'-end of the transcript B. Poly (A) Tail: the addition of lots of adenine residues to the 3'-end of the transcript C. Splicing: removal of non-coding sequences, introns, from the transcript D. Denaturation: using formamide to denature the transcript D A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. The concentration of DNA in this extract is: A. 76.35 micrograms/mL B. 3817.5 micrograms/mL C. 381.75 micrograms/mL D. 3054.0 micrograms/mL B (2.545 30 50 ) 50 for DNA 40 for RNA This enzyme is crucial in the making RNA from DNA: A. DNA Polymerase B. RNA Polymerase C. Helicase D. Primase B The nitrogenous base in a nucleotide is expected to be found on which position of the sugar? A. C1' B. C2' C. C3' D. C5' A Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: A. Klenow fragment of DNA polymerase B. Okazaki fragments C. Sanger fragments D. RNA fragments B The process of making RNA is termed: A. Replication B. Translation C. Transcription D. Polymerase chain reaction C The enzyme that primes DNA synthesis is: A. DNA polymerase B. Exonuclease C. DNA ligase D. DNA primase D Purines and pyrimidines differ from each other in that: A. Purines are found RNA; pyrimidines are found in DNA B. There's no difference between purines and pyrimidines C. Pyrimidines have two rings; purines have one ring D. Purines have two rings; pyrimidines have one ring D The phosphate group in a nucleotide is expected to be found on which position of the sugar? A. C1' B. C2' C. C4' D. C5' D All of the following are components of nucleic acids, EXCEPT: A. Phosphate group B. Sugar (ribose or deoxyribose) C. Nitrogenous base (A, G, C, T) D. Formamide D The hydroxyl group in a deoxyribonucleotide is expected to be found on which position of the sugar? A. C1' B. C2' C. C3' D. C4' C In real-time PCR, what is amplified? A. The target B. The signal C. The probe D. All of the above A Which of the following is not a PCR step? A. Denaturation B. Elongation C. Annealing D. Termination D In hybrid capture technology, _______ is used to amplify the _______ Alkaline phosphatase; signal All of the following methods of amplification are considered target amplification, except: A. Quantitative PCR B. NASBA C. Strand Displacement Amplification D. Reverse Transcriptase PCR C Consider a hypothetical mutation involving gene X. Let's say you amplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a C>T mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: A. +/+ = 350 bp; 250 bp; 100 bp; B. m/+ = Only the 350 bp C. m/+ = 350 bp; 250 bp; 100 bp D. m/m = 350 bp; 250 bp C As a technologist working in a small clinical laboratory, a nasal swab specimen, suspected to be colonized by a variety of upper respiratory viruses, came to your laboratory. You are tasked with determining whether the specimen is colonized with rhinovirus, coronavirus, and influenza. Which PCR method would best be suitable for this task? A. Nested PCR B. Real-time PCR C. NASBA D. Multiplex PCR D Which of the following is least likely to increase the specificity of a PCR reaction? A. Incorporate DMSO or formamide into the PCR reaction B. Use nested PCR C. Decrease the annealing temperature of primers D. Use a high fidelity polymerase having 3 C Of the following PCR based methodologies listed below, which employs a set of primer pairs designed in such a way that they overlap, but only one will bind to the target in the presences of SNPs? A. Amplification Refractory Mutation System (ARMS) B. PCR-RFLP C. Heteroduplex analysis D. Dot/slot blot A Branched DNA amplification (bDNA) is best classified as: A. Signal amplification B. Target amplification C. Probe amplification D. None of the above A After an amplification procedure followed by gel electrophoresis, you took a photo of your gel. You notice consistent bands in all your gel lanes. However, you also see what appears to be a faint but noticeable band in your reagent blank lane. What is your best explanation for the reagent blank band? A. Taq polymerase concentration was too low in this PCR reaction B. There was obvious contamination in this PCR reaction C. The primers concentration was too high in this PCR reaction D. The dNTPs concentration was too high in this PCR reaction B In which of the following methods is the probe digested by the polymerase (Taq) during primer extension? A. Taqman B. FRET probes C. Molecular beacons D. Scorpion probes A This PCR method works by generating a signal at the annealing step (i.e. when the probe binds its target) of the PCR reaction: A. FRET probes B. Scorpion primers C. Molecular beacons D. Taqman C What enzyme is involved in LCR? A. Taq polymerase B. RNA polymerase C. DNA Ligase D. Luciferase C A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a singlegene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntington gene. Testing with standard PCR indicates that patient has Huntington Disease, HD. Which of the following would be consistent with this diagnosis? A. 25 CAG repeats in the Huntington gene B. 85 CAG repeats in the Huntington gene C. 25 CGA repeats in the Huntington gene D. 85 CGA repeats in the Huntington gene B ( 40+ repeats for Huntington disease) According to Chargaff's rule of base pairing, adenine pairs with: A. Cytosine B. Threonine C. Thymine D. Thymidine C Mutation in this gene (Xp21) is associated with Duchenne Muscular Dystrophy (DMD) A. Dystrophin B. P53 C. Musculin D. c-myc A This translocation creates a fusion protein between the Abl1 gene on one chromosome and the BCR gene on the other chromosome, resulting in chronic myelogenous leukemia (CML): A. t(11;18) B. t(9;22) C. t(14;18) D. t(X;18) B Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? A. Increase the concentration of salt in the wash solution buffer B. Increase the temperature from, say 68 Celcius to 75 Celcius C. Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density D. Remove formamide from the wash solution buffer A The rate of DNA migration through an agarose gel during electrophoresis does not depend on which of the following factors? A. Net charge of the molecule B. Size of the molecule C. Shape of the molecule D. Nucleotide sequence of the molecule D Which of the following is NOT a mutation found in the HFE gene of hemachromatosis? A. C282Y B. H63D C. 5382insC D. S65C C since ABD are HFE common mutation Blame this translocation on synovial sarcoma, a muscle and fibrous tissue cancer: A. t(8;X) B. t(18;X) C. t(9;12) D. t(15;17) B The mother of a 3 year old boy took him to the doctor's office for concerns of an underlying genetic condition. A karyotype order was sent to the Molecular Diagnostic lab for a karyotype. Karyotype results show 47, XY,+21. Based on these results, the boy has: A. Patau Syndrome B. Down Syndrome C. Edward Syndrome D. Cri du chat Syndrome B (Down syndrome maybe associated with Robertsonian translocation) A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is: A. 3540 micrograms B. 3450 micrograms C. 3504 micrograms D. 3054 micrograms D. (2.545 x 50ng/mcl)=127.25 (127.25ng/mcl * 0.30) = 38.175ng/mcl 38.175ng/mcl ( 0.800mL1000) =3054 micrograms Bone marrow transplantation is used to treat several malignant and benign cancers, particularly leukemias. Donor matching to assess immune system compatibility is a central step of any transplantation procedure. Blood samples for both a donor and a recipient were sent to your lab for a possible bone marrow transplantation analysis. For a pre-transplantion assessment, your lab performed amplification of the DNA samples (specific loci) of both donor and recipient, then resolved the DNA on polyacrilamide gel. 90 days later after transplantation (assuming donor matching was successful), a blood specimen from the recipient was sent to your lab to assess whether or not transplantation was successful. The gel result obtained is shown below. (Note: R=Recipient; D=Donor; M=Molecular Weight Maker; left side of gel =pre-transplantation; right side of gel=post-transplantation). Based on the gel image above, what can be said about the transplant procedure? A. The transplant was successful! B. The transplant was unsuccessful! C. Not enough information provided! C Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60 °C B. 58 °C C. 64 °C D. 62 °C B All of the following are trinucleotide repeat disorders, EXCEPT: A. Spinocerebellar Ataxia Type 8 B. Huntington Disease C. Asperger Disease D. Fragile X Disease C Of the following PCR based methodologies listed below, which employs a set of primer pairs designed in such a way that they overlap, but only one will bind to the target in the presences of SNPs? A. Amplification Refractory Mutation System (ARMS) B. PCR-RFLP C. Heteroduplex analysis D. Dot/slot blot A The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntington gene. Which of these methods would best accomplish this task? A. Standard PCR B. PFGE C. RAPD PCR D. Methylation-specific PCR A What volume of DNA (in microliters) is required to prepare a restriction digest that requires 10ugs of DNA when the stock DNA is 5ug/ul? A. 0.5 ul B. 1ul C. 2ul D. 5ul C The hydroxyl group in a deoxyribonucleotide is expected to be found on which position of the sugar? A. C1' B. C2' C. C3' D. C4' C